Review





Similar Products

94
Sino Biological ccl21 his protein
Ccl21 His Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccl21 his protein/product/Sino Biological
Average 94 stars, based on 1 article reviews
ccl21 his protein - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
R&D Systems ccl21a
( A ) scRNA-seq of 129/Sj anterior segment tissue identifies various cell types similar to that in C57BL/6 J single-cell RNA sequencing (left panel). Expression of Egfl7 and Cdh5 in snRNA-seq endothelial cells (right panel). ( B ) Integration of B6 and 129/Sj endothelial cells followed by sub-clustering identifies BECs, LECs, IW1 SECs, IW2 SECs, OW SECs, and CCs (top panel). Integration of B6 and 129/Sj endothelial cells distributed across clusters (bottom panel). ( C ) Sub-clustering identifies complementary expression patterns of Npnt and <t>Ccl21a</t> in IW1 and IW2 SECs, Ackr1 in CCs, and Selp in OW SECs. ( D ) Heatmap of differentially expressed genes of the identified sub-clusters. ( E ) Violin plot showing differences in expression levels of various genes which as a combination defines individual sub-clusters. IW: Inner wall, OW: Outer wall, CC: Collector channels, BEC: Blood endothelial cell, LEC: Lymphatic endothelial cell, SEC: Schlemm’s Canal endothelial cell.
Ccl21a, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ccl21a/product/R&D Systems
Average 93 stars, based on 1 article reviews
ccl21a - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
PeproTech recombinant mouse ccl21
( A ) scRNA-seq of 129/Sj anterior segment tissue identifies various cell types similar to that in C57BL/6 J single-cell RNA sequencing (left panel). Expression of Egfl7 and Cdh5 in snRNA-seq endothelial cells (right panel). ( B ) Integration of B6 and 129/Sj endothelial cells followed by sub-clustering identifies BECs, LECs, IW1 SECs, IW2 SECs, OW SECs, and CCs (top panel). Integration of B6 and 129/Sj endothelial cells distributed across clusters (bottom panel). ( C ) Sub-clustering identifies complementary expression patterns of Npnt and <t>Ccl21a</t> in IW1 and IW2 SECs, Ackr1 in CCs, and Selp in OW SECs. ( D ) Heatmap of differentially expressed genes of the identified sub-clusters. ( E ) Violin plot showing differences in expression levels of various genes which as a combination defines individual sub-clusters. IW: Inner wall, OW: Outer wall, CC: Collector channels, BEC: Blood endothelial cell, LEC: Lymphatic endothelial cell, SEC: Schlemm’s Canal endothelial cell.
Recombinant Mouse Ccl21, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant mouse ccl21/product/PeproTech
Average 90 stars, based on 1 article reviews
recombinant mouse ccl21 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Novus Biologicals mouse anti-ccl21/6ckine mo146-2h26
( A ) scRNA-seq of 129/Sj anterior segment tissue identifies various cell types similar to that in C57BL/6 J single-cell RNA sequencing (left panel). Expression of Egfl7 and Cdh5 in snRNA-seq endothelial cells (right panel). ( B ) Integration of B6 and 129/Sj endothelial cells followed by sub-clustering identifies BECs, LECs, IW1 SECs, IW2 SECs, OW SECs, and CCs (top panel). Integration of B6 and 129/Sj endothelial cells distributed across clusters (bottom panel). ( C ) Sub-clustering identifies complementary expression patterns of Npnt and <t>Ccl21a</t> in IW1 and IW2 SECs, Ackr1 in CCs, and Selp in OW SECs. ( D ) Heatmap of differentially expressed genes of the identified sub-clusters. ( E ) Violin plot showing differences in expression levels of various genes which as a combination defines individual sub-clusters. IW: Inner wall, OW: Outer wall, CC: Collector channels, BEC: Blood endothelial cell, LEC: Lymphatic endothelial cell, SEC: Schlemm’s Canal endothelial cell.
Mouse Anti Ccl21/6ckine Mo146 2h26, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti-ccl21/6ckine mo146-2h26/product/Novus Biologicals
Average 90 stars, based on 1 article reviews
mouse anti-ccl21/6ckine mo146-2h26 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PeproTech mouse ccl21 (6ckine) recombinant protein
(A) IFM of naive pLN (left) or pLN 24 h post-footpad LCMV infection (right). Sections stained for PNAd+ HEVs, IgD, and <t>CCL21.</t> Scale bars, 100 μm. (B) Zoomed-in views of HEVs in naive (top) and inflamed (bottom) LNs. Scale bars, 20 μm. (C) RT-qPCR for <t>Ccl21</t> in LNs (draining popliteal, sub-draining inguinal, or non-draining brachial) that were responding to either saline or LCMV. Each dot represents a mouse LN pair. (D) RNA-scope images of Ch25h and Cyp7b1 (red) in LNs co-stained for IgD (brown). Images are representative of at least 3 mice. Scale bars, 100 μm. (E) RT-qPCR for Ch25h and Cyp7b1 in sorted pLN HEVs, BECs, FRCs, or DN stromal cells. (F) RT-qPCR for Ch25h in LNs as in (C). (G) RT-qPCR for Ch25h and Ccl21 in LN stromal cells sorted from LCMV-draining pLNs or non-draining bLNs. Each dot represents pooled sorted cells from 6 mice in (E) and (G). All statistical tests are two-tailed unpaired t tests. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant ( p > 0.05). Means ± standard deviation indicated in summary graphs. See also .
Mouse Ccl21 (6ckine) Recombinant Protein, supplied by PeproTech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse ccl21 (6ckine) recombinant protein/product/PeproTech
Average 90 stars, based on 1 article reviews
mouse ccl21 (6ckine) recombinant protein - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

99
OriGene mouse ccl21 forward 50 ggctataggaagcaagaaccaagt
(A) IFM of naive pLN (left) or pLN 24 h post-footpad LCMV infection (right). Sections stained for PNAd+ HEVs, IgD, and <t>CCL21.</t> Scale bars, 100 μm. (B) Zoomed-in views of HEVs in naive (top) and inflamed (bottom) LNs. Scale bars, 20 μm. (C) RT-qPCR for <t>Ccl21</t> in LNs (draining popliteal, sub-draining inguinal, or non-draining brachial) that were responding to either saline or LCMV. Each dot represents a mouse LN pair. (D) RNA-scope images of Ch25h and Cyp7b1 (red) in LNs co-stained for IgD (brown). Images are representative of at least 3 mice. Scale bars, 100 μm. (E) RT-qPCR for Ch25h and Cyp7b1 in sorted pLN HEVs, BECs, FRCs, or DN stromal cells. (F) RT-qPCR for Ch25h in LNs as in (C). (G) RT-qPCR for Ch25h and Ccl21 in LN stromal cells sorted from LCMV-draining pLNs or non-draining bLNs. Each dot represents pooled sorted cells from 6 mice in (E) and (G). All statistical tests are two-tailed unpaired t tests. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant ( p > 0.05). Means ± standard deviation indicated in summary graphs. See also .
Mouse Ccl21 Forward 50 Ggctataggaagcaagaaccaagt, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse ccl21 forward 50 ggctataggaagcaagaaccaagt/product/OriGene
Average 99 stars, based on 1 article reviews
mouse ccl21 forward 50 ggctataggaagcaagaaccaagt - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

93
R&D Systems rat anti mhc ii
(A) IFM of naive pLN (left) or pLN 24 h post-footpad LCMV infection (right). Sections stained for PNAd+ HEVs, IgD, and <t>CCL21.</t> Scale bars, 100 μm. (B) Zoomed-in views of HEVs in naive (top) and inflamed (bottom) LNs. Scale bars, 20 μm. (C) RT-qPCR for <t>Ccl21</t> in LNs (draining popliteal, sub-draining inguinal, or non-draining brachial) that were responding to either saline or LCMV. Each dot represents a mouse LN pair. (D) RNA-scope images of Ch25h and Cyp7b1 (red) in LNs co-stained for IgD (brown). Images are representative of at least 3 mice. Scale bars, 100 μm. (E) RT-qPCR for Ch25h and Cyp7b1 in sorted pLN HEVs, BECs, FRCs, or DN stromal cells. (F) RT-qPCR for Ch25h in LNs as in (C). (G) RT-qPCR for Ch25h and Ccl21 in LN stromal cells sorted from LCMV-draining pLNs or non-draining bLNs. Each dot represents pooled sorted cells from 6 mice in (E) and (G). All statistical tests are two-tailed unpaired t tests. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant ( p > 0.05). Means ± standard deviation indicated in summary graphs. See also .
Rat Anti Mhc Ii, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat anti mhc ii/product/R&D Systems
Average 93 stars, based on 1 article reviews
rat anti mhc ii - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
R&D Systems goat anti ccl21
(A) IFM of naive pLN (left) or pLN 24 h post-footpad LCMV infection (right). Sections stained for PNAd+ HEVs, IgD, and <t>CCL21.</t> Scale bars, 100 μm. (B) Zoomed-in views of HEVs in naive (top) and inflamed (bottom) LNs. Scale bars, 20 μm. (C) RT-qPCR for <t>Ccl21</t> in LNs (draining popliteal, sub-draining inguinal, or non-draining brachial) that were responding to either saline or LCMV. Each dot represents a mouse LN pair. (D) RNA-scope images of Ch25h and Cyp7b1 (red) in LNs co-stained for IgD (brown). Images are representative of at least 3 mice. Scale bars, 100 μm. (E) RT-qPCR for Ch25h and Cyp7b1 in sorted pLN HEVs, BECs, FRCs, or DN stromal cells. (F) RT-qPCR for Ch25h in LNs as in (C). (G) RT-qPCR for Ch25h and Ccl21 in LN stromal cells sorted from LCMV-draining pLNs or non-draining bLNs. Each dot represents pooled sorted cells from 6 mice in (E) and (G). All statistical tests are two-tailed unpaired t tests. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant ( p > 0.05). Means ± standard deviation indicated in summary graphs. See also .
Goat Anti Ccl21, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat anti ccl21/product/R&D Systems
Average 93 stars, based on 1 article reviews
goat anti ccl21 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
R&D Systems anti-mouse ccl21 antibody
A Measurement of chemokine concentrations in peripheral lymph nodes from psoriatic mice (n = 5). B Relative Ccl21a expression in different tissues of psoriatic mice (n = 5). Significant differences in comparison with lymph nodes. C Representative images and quantification of MSC recruited by the homogenate of lymph node from psoriatic mice in the presence of <t>anti-CCL21</t> antibody (n = 5). D Illustration of the scheme depicting MSC treatment for psoriatic mice pretreated with <t>anti-CCL21</t> antibody. E Quantification of MSC in the peripheral lymph nodes of psoriatic mice pretreated with anti-CCL21 antibody 24 h after MSC administration (n = 5). F In vivo IVIM imaging of MSC-RFP in inguinal lymph nodes from psoriatic mice pretreated with anti-CCL21 antibody. Scale bar, 100 μm. G Immunofluorescence colocalization analysis of CCL21 with high endothelial cells (MECA-79) or lymphatic endothelial cells (LYVE) in the peripheral lymph nodes of normal mice and psoriatic mice. Scale bars, 100 μm. H Secreted protein levels of CCL21 in SVEC-10 cells stimulated with lymph node homogenate for 16 h were analyzed 8 h after media refreshment (n = 5). I Quantification of MSC recruited in a transwell culture system by conditioned medium collected after the stimulation of SVEC4-10 cells with lymph node homogenate for 16 h (n = 5). J CCR7 expression in MSC stimulated with mouse serum for 24 h was determined by flow cytometry (n = 5). The data are presented as the means ± SEMs. *P < 0.05, ** P < 0.01 and *** P < 0.001.
Anti Mouse Ccl21 Antibody, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-mouse ccl21 antibody/product/R&D Systems
Average 90 stars, based on 1 article reviews
anti-mouse ccl21 antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


( A ) scRNA-seq of 129/Sj anterior segment tissue identifies various cell types similar to that in C57BL/6 J single-cell RNA sequencing (left panel). Expression of Egfl7 and Cdh5 in snRNA-seq endothelial cells (right panel). ( B ) Integration of B6 and 129/Sj endothelial cells followed by sub-clustering identifies BECs, LECs, IW1 SECs, IW2 SECs, OW SECs, and CCs (top panel). Integration of B6 and 129/Sj endothelial cells distributed across clusters (bottom panel). ( C ) Sub-clustering identifies complementary expression patterns of Npnt and Ccl21a in IW1 and IW2 SECs, Ackr1 in CCs, and Selp in OW SECs. ( D ) Heatmap of differentially expressed genes of the identified sub-clusters. ( E ) Violin plot showing differences in expression levels of various genes which as a combination defines individual sub-clusters. IW: Inner wall, OW: Outer wall, CC: Collector channels, BEC: Blood endothelial cell, LEC: Lymphatic endothelial cell, SEC: Schlemm’s Canal endothelial cell.

Journal: eLife

Article Title: Transcriptomic profiling of Schlemm’s canal cells reveals a lymphatic-biased identity and three major cell states

doi: 10.7554/eLife.96459

Figure Lengend Snippet: ( A ) scRNA-seq of 129/Sj anterior segment tissue identifies various cell types similar to that in C57BL/6 J single-cell RNA sequencing (left panel). Expression of Egfl7 and Cdh5 in snRNA-seq endothelial cells (right panel). ( B ) Integration of B6 and 129/Sj endothelial cells followed by sub-clustering identifies BECs, LECs, IW1 SECs, IW2 SECs, OW SECs, and CCs (top panel). Integration of B6 and 129/Sj endothelial cells distributed across clusters (bottom panel). ( C ) Sub-clustering identifies complementary expression patterns of Npnt and Ccl21a in IW1 and IW2 SECs, Ackr1 in CCs, and Selp in OW SECs. ( D ) Heatmap of differentially expressed genes of the identified sub-clusters. ( E ) Violin plot showing differences in expression levels of various genes which as a combination defines individual sub-clusters. IW: Inner wall, OW: Outer wall, CC: Collector channels, BEC: Blood endothelial cell, LEC: Lymphatic endothelial cell, SEC: Schlemm’s Canal endothelial cell.

Article Snippet: Antibody , CCL21A (Goat polyclonal) , R&D Systems , Cat# AF457-SP; RRID: AB_2072083 , WM (1:25) Sections (1:200).

Techniques: RNA Sequencing Assay, Expressing

( A ) Npnt expression in a subgroup of SEC in scRNA-seq data (i) and corresponding immunofluorescence (IF) reveals high level of expression of NPNT in anterior portion of IW of SC in a frozen section (ii) and whole mount (iii and iv). ( B ) Ccl21a is expressed in SECs and LECs (i) and corresponding IF reveals high expression in posterior portion of IW of SC in a frozen section (ii) and whole mount (iii and iv). ( C ) Selp is expressed in OW SECs and CCs, a subgroup of SECs in single-cell (i) and corresponding IF (ii frozen section, iii-iv whole mount). ( D ) Ackr1 expression in a subset of CC cells (i) and corresponding IF (ii frozen section, iii whole mount). DAPI in blue labels nuclei in all panels. IW: Inner wall, OW: Outer wall, CC: Collector channels, CB: Ciliary body, LY: Lymphatic vessels, BV: Blood vessels SC: Schlemm’s canal. Ant.: Anterior SC, Post.: Posterior SC. Scale bar = 100μm.

Journal: eLife

Article Title: Transcriptomic profiling of Schlemm’s canal cells reveals a lymphatic-biased identity and three major cell states

doi: 10.7554/eLife.96459

Figure Lengend Snippet: ( A ) Npnt expression in a subgroup of SEC in scRNA-seq data (i) and corresponding immunofluorescence (IF) reveals high level of expression of NPNT in anterior portion of IW of SC in a frozen section (ii) and whole mount (iii and iv). ( B ) Ccl21a is expressed in SECs and LECs (i) and corresponding IF reveals high expression in posterior portion of IW of SC in a frozen section (ii) and whole mount (iii and iv). ( C ) Selp is expressed in OW SECs and CCs, a subgroup of SECs in single-cell (i) and corresponding IF (ii frozen section, iii-iv whole mount). ( D ) Ackr1 expression in a subset of CC cells (i) and corresponding IF (ii frozen section, iii whole mount). DAPI in blue labels nuclei in all panels. IW: Inner wall, OW: Outer wall, CC: Collector channels, CB: Ciliary body, LY: Lymphatic vessels, BV: Blood vessels SC: Schlemm’s canal. Ant.: Anterior SC, Post.: Posterior SC. Scale bar = 100μm.

Article Snippet: Antibody , CCL21A (Goat polyclonal) , R&D Systems , Cat# AF457-SP; RRID: AB_2072083 , WM (1:25) Sections (1:200).

Techniques: Expressing, Immunofluorescence

( A ) Immunofluorescence (IF) of NPNT shows variability in expression with a gradient of high expression in the anterior portion of SC (left panel) and uniform expression throughout IW of SC (middle panel) in flash-frozen sections. In situ hybridization using RNAscope shows the expression of Npnt in IW with an anterior expression bias (left panel) ( B ) IF of CCL21A shows variability in expression with a gradient of high expression in the posterior portion of SC (right panel) and uniform expression throughout IW of SC (left panel) in flash-frozen sections. DAPI in blue labels nuclei in all panels. ( C, D ) Gene expression analysis of endothelial cell subset in published dataset shows similar segregation of Npnt, Selp, and Ccl21a expression in SECs as seen in our dataset. CB: ciliary body, SC: Schlemm’s canal. Ant.: Anterior Schlemm’s canal, Post.: Posterior Schlemm’s canal. Scale bar = 100μm.

Journal: eLife

Article Title: Transcriptomic profiling of Schlemm’s canal cells reveals a lymphatic-biased identity and three major cell states

doi: 10.7554/eLife.96459

Figure Lengend Snippet: ( A ) Immunofluorescence (IF) of NPNT shows variability in expression with a gradient of high expression in the anterior portion of SC (left panel) and uniform expression throughout IW of SC (middle panel) in flash-frozen sections. In situ hybridization using RNAscope shows the expression of Npnt in IW with an anterior expression bias (left panel) ( B ) IF of CCL21A shows variability in expression with a gradient of high expression in the posterior portion of SC (right panel) and uniform expression throughout IW of SC (left panel) in flash-frozen sections. DAPI in blue labels nuclei in all panels. ( C, D ) Gene expression analysis of endothelial cell subset in published dataset shows similar segregation of Npnt, Selp, and Ccl21a expression in SECs as seen in our dataset. CB: ciliary body, SC: Schlemm’s canal. Ant.: Anterior Schlemm’s canal, Post.: Posterior Schlemm’s canal. Scale bar = 100μm.

Article Snippet: Antibody , CCL21A (Goat polyclonal) , R&D Systems , Cat# AF457-SP; RRID: AB_2072083 , WM (1:25) Sections (1:200).

Techniques: Immunofluorescence, Expressing, In Situ Hybridization, RNAscope

Journal: eLife

Article Title: Transcriptomic profiling of Schlemm’s canal cells reveals a lymphatic-biased identity and three major cell states

doi: 10.7554/eLife.96459

Figure Lengend Snippet:

Article Snippet: Antibody , CCL21A (Goat polyclonal) , R&D Systems , Cat# AF457-SP; RRID: AB_2072083 , WM (1:25) Sections (1:200).

Techniques: Transgenic Assay, Staining, Immunofluorescence, RNA Sequencing Assay

(A) IFM of naive pLN (left) or pLN 24 h post-footpad LCMV infection (right). Sections stained for PNAd+ HEVs, IgD, and CCL21. Scale bars, 100 μm. (B) Zoomed-in views of HEVs in naive (top) and inflamed (bottom) LNs. Scale bars, 20 μm. (C) RT-qPCR for Ccl21 in LNs (draining popliteal, sub-draining inguinal, or non-draining brachial) that were responding to either saline or LCMV. Each dot represents a mouse LN pair. (D) RNA-scope images of Ch25h and Cyp7b1 (red) in LNs co-stained for IgD (brown). Images are representative of at least 3 mice. Scale bars, 100 μm. (E) RT-qPCR for Ch25h and Cyp7b1 in sorted pLN HEVs, BECs, FRCs, or DN stromal cells. (F) RT-qPCR for Ch25h in LNs as in (C). (G) RT-qPCR for Ch25h and Ccl21 in LN stromal cells sorted from LCMV-draining pLNs or non-draining bLNs. Each dot represents pooled sorted cells from 6 mice in (E) and (G). All statistical tests are two-tailed unpaired t tests. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant ( p > 0.05). Means ± standard deviation indicated in summary graphs. See also .

Journal: Cell

Article Title: Inflammation switches the chemoattractant requirements for naive lymphocyte entry into lymph nodes

doi: 10.1016/j.cell.2024.11.031

Figure Lengend Snippet: (A) IFM of naive pLN (left) or pLN 24 h post-footpad LCMV infection (right). Sections stained for PNAd+ HEVs, IgD, and CCL21. Scale bars, 100 μm. (B) Zoomed-in views of HEVs in naive (top) and inflamed (bottom) LNs. Scale bars, 20 μm. (C) RT-qPCR for Ccl21 in LNs (draining popliteal, sub-draining inguinal, or non-draining brachial) that were responding to either saline or LCMV. Each dot represents a mouse LN pair. (D) RNA-scope images of Ch25h and Cyp7b1 (red) in LNs co-stained for IgD (brown). Images are representative of at least 3 mice. Scale bars, 100 μm. (E) RT-qPCR for Ch25h and Cyp7b1 in sorted pLN HEVs, BECs, FRCs, or DN stromal cells. (F) RT-qPCR for Ch25h in LNs as in (C). (G) RT-qPCR for Ch25h and Ccl21 in LN stromal cells sorted from LCMV-draining pLNs or non-draining bLNs. Each dot represents pooled sorted cells from 6 mice in (E) and (G). All statistical tests are two-tailed unpaired t tests. * p < 0.05; ** p < 0.01; *** p < 0.001; ns, not significant ( p > 0.05). Means ± standard deviation indicated in summary graphs. See also .

Article Snippet: Mouse CCL21 (6Ckine) Recombinant Protein , PeproTech , Cat# 250–13-20UG.

Techniques: Infection, Staining, Quantitative RT-PCR, Saline, RNAscope, Two Tailed Test, Standard Deviation

KEY RESOURCES TABLE

Journal: Cell

Article Title: Inflammation switches the chemoattractant requirements for naive lymphocyte entry into lymph nodes

doi: 10.1016/j.cell.2024.11.031

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Mouse CCL21 (6Ckine) Recombinant Protein , PeproTech , Cat# 250–13-20UG.

Techniques: Control, Virus, Recombinant, Adjuvant, Reverse Transcription, RNAscope, SYBR Green Assay, Plasmid Preparation, Software

A Measurement of chemokine concentrations in peripheral lymph nodes from psoriatic mice (n = 5). B Relative Ccl21a expression in different tissues of psoriatic mice (n = 5). Significant differences in comparison with lymph nodes. C Representative images and quantification of MSC recruited by the homogenate of lymph node from psoriatic mice in the presence of anti-CCL21 antibody (n = 5). D Illustration of the scheme depicting MSC treatment for psoriatic mice pretreated with anti-CCL21 antibody. E Quantification of MSC in the peripheral lymph nodes of psoriatic mice pretreated with anti-CCL21 antibody 24 h after MSC administration (n = 5). F In vivo IVIM imaging of MSC-RFP in inguinal lymph nodes from psoriatic mice pretreated with anti-CCL21 antibody. Scale bar, 100 μm. G Immunofluorescence colocalization analysis of CCL21 with high endothelial cells (MECA-79) or lymphatic endothelial cells (LYVE) in the peripheral lymph nodes of normal mice and psoriatic mice. Scale bars, 100 μm. H Secreted protein levels of CCL21 in SVEC-10 cells stimulated with lymph node homogenate for 16 h were analyzed 8 h after media refreshment (n = 5). I Quantification of MSC recruited in a transwell culture system by conditioned medium collected after the stimulation of SVEC4-10 cells with lymph node homogenate for 16 h (n = 5). J CCR7 expression in MSC stimulated with mouse serum for 24 h was determined by flow cytometry (n = 5). The data are presented as the means ± SEMs. *P < 0.05, ** P < 0.01 and *** P < 0.001.

Journal: Cell Death & Disease

Article Title: Mesenchymal stromal cells restrain the Th17 cell response via L-amino-acid oxidase within lymph nodes

doi: 10.1038/s41419-024-07024-7

Figure Lengend Snippet: A Measurement of chemokine concentrations in peripheral lymph nodes from psoriatic mice (n = 5). B Relative Ccl21a expression in different tissues of psoriatic mice (n = 5). Significant differences in comparison with lymph nodes. C Representative images and quantification of MSC recruited by the homogenate of lymph node from psoriatic mice in the presence of anti-CCL21 antibody (n = 5). D Illustration of the scheme depicting MSC treatment for psoriatic mice pretreated with anti-CCL21 antibody. E Quantification of MSC in the peripheral lymph nodes of psoriatic mice pretreated with anti-CCL21 antibody 24 h after MSC administration (n = 5). F In vivo IVIM imaging of MSC-RFP in inguinal lymph nodes from psoriatic mice pretreated with anti-CCL21 antibody. Scale bar, 100 μm. G Immunofluorescence colocalization analysis of CCL21 with high endothelial cells (MECA-79) or lymphatic endothelial cells (LYVE) in the peripheral lymph nodes of normal mice and psoriatic mice. Scale bars, 100 μm. H Secreted protein levels of CCL21 in SVEC-10 cells stimulated with lymph node homogenate for 16 h were analyzed 8 h after media refreshment (n = 5). I Quantification of MSC recruited in a transwell culture system by conditioned medium collected after the stimulation of SVEC4-10 cells with lymph node homogenate for 16 h (n = 5). J CCR7 expression in MSC stimulated with mouse serum for 24 h was determined by flow cytometry (n = 5). The data are presented as the means ± SEMs. *P < 0.05, ** P < 0.01 and *** P < 0.001.

Article Snippet: To neutralizing CCL21, mice received 10 μg of anti-mouse CCL21 antibody or control IgG (R&D System, Minneapolis, MN) 16 h before MSC infusion.

Techniques: Expressing, Comparison, In Vivo, Imaging, Immunofluorescence, Flow Cytometry

In mice with autoimmune diseases, elevated CCL21 levels drive the specific homing of MSC to lymph nodes following transplantation. Within the lymph nodes, MSC respond to TNF-α stimulation by secreting LAAO via NF-κB activation. LAAO catalyzes the production of I3P from tryptophan, which exhibits strong inhibitory effects on Th17 cells by activating the AHR pathway. The figure was created with BioRender ( https://biorender.com ).

Journal: Cell Death & Disease

Article Title: Mesenchymal stromal cells restrain the Th17 cell response via L-amino-acid oxidase within lymph nodes

doi: 10.1038/s41419-024-07024-7

Figure Lengend Snippet: In mice with autoimmune diseases, elevated CCL21 levels drive the specific homing of MSC to lymph nodes following transplantation. Within the lymph nodes, MSC respond to TNF-α stimulation by secreting LAAO via NF-κB activation. LAAO catalyzes the production of I3P from tryptophan, which exhibits strong inhibitory effects on Th17 cells by activating the AHR pathway. The figure was created with BioRender ( https://biorender.com ).

Article Snippet: To neutralizing CCL21, mice received 10 μg of anti-mouse CCL21 antibody or control IgG (R&D System, Minneapolis, MN) 16 h before MSC infusion.

Techniques: Transplantation Assay, Activation Assay